MirGeneDB

MirGeneDB ID

Sto-Mir-27-P2

Family name MIR-27 (all species)
Seed UCACAGU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-27-o1  Sto-Mir-27-P1 
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Dre-Mir-27-P2a  Dre-Mir-27-P2b  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Oan-Mir-27-P2  Ocu-Mir-27-P2  Rno-Mir-27-P2  Sha-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002700.1: 246153-246216 [-]
Precursor
(pre-Mir +30nt flank)
UCCAUCGAAUAUGACCUUUCUGGUGAGGUACAGAGCUUAGCUGAUUGGUGAACAGUGAUCAUUUUUGCUUUGUUCACAGUGGCUAAGUUCUGCACCAACGAGAGGGAAUGAUGAUCAGGGCUGU
Get precursor sequence
Structure
        10           20        30        40        50        60  
UCCAUCGAAUAUGACCU---|   G  GA   A             AUUG       GUGAUCA 
                    UUCU GU  GGU CAGAGCUUAGCUG    GUGAACA       U
                    GAGA CA  CCA GUCUUGAAUCGGU    CACUUGU       U
UGUCGGGACUAGUAGUAAGG^   G  A-   C             GA--       UUCGUUU 
  120       110       100         90        80          70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site +1 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Sto-Mir-27-P2_5p*

MirBase accessionNone
Sequence
0- CAGAGCUUAGCUGAUUGGUGAACA -24
Get sequence
Mature sequence

Sto-Mir-27-P2_3p

MirBase accessionNone
Sequence
42- UUCACAGUGGCUAAGUUCUGCA -64
Get sequence