MirGeneDB

MirGeneDB ID

Oan-Mir-27-P2

Family name MIR-27 (all species)
Seed UCACAGU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-27b
Paralogues Oan-Mir-27-P1 
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Dre-Mir-27-P2a  Dre-Mir-27-P2b  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Ocu-Mir-27-P2  Rno-Mir-27-P2  Sha-Mir-27-P2  Sto-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041753.1: 69581278-69581340 [+]
Clustered MiRNAs
(< 10kb from Mir-27-P2)
Mir-23-P2 NC_041753.1: 69581117-69581177 [+]
Mir-27-P2 NC_041753.1: 69581278-69581340 [+]
Mir-24-P2 NC_041753.1: 69581866-69581924 [+]
Precursor
(pre-Mir +30nt flank)
GGCCGUCUCUCUGUCUCUCUGUCGCGGCGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGCUGGACUCUUUGUUCACAGUGGCUAAGUUCUGCGCCCGCAGAGAAGGGGACGGACGGCGCGGA
Get precursor sequence
Structure
        10            20        30        40        50        60  
GGCCGUCUCUCUGUCUC----|   U  C                 AUUG      AGUGAUUGC 
                     UCUG CG GGCGCAGAGCUUAGCUG    GUGAAC         \
                     AGAC GC CCGCGUCUUGAAUCGGU    CACUUG         U
AGGCGCGGCAGGCAGGGGAAG^   -  -                 GA--      UUUCUCAGG 
 120       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Oan-Mir-27-P2_5p*

MirBase accessionMIMAT0006956
Sequence
0- AGAGCUUAGCUGAUUGGUGAAC -22
Get sequence
Mature sequence

Oan-Mir-27-P2_3p

MirBase accessionMIMAT0006957
Sequence
42- UUCACAGUGGCUAAGUUCUGC -63
Get sequence