MirGeneDB

MirGeneDB ID

Oan-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-23b
Paralogues Oan-Mir-23-P1 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041753.1: 69581117-69581177 [+]
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-23-P2 NC_041753.1: 69581117-69581177 [+]
Mir-27-P2 NC_041753.1: 69581278-69581340 [+]
Mir-24-P2 NC_041753.1: 69581866-69581924 [+]
Precursor
(pre-Mir +30nt flank)
CCCCCCGCGAUCGAUCCCGGCCCGGCUGCCUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAGAAAAAUCACAUUGCCAGGGAUAACCACGCAUCCGGGACCGCCCCCCGCCGCCCUCCC
Get precursor sequence
Structure
        10        20         30          40         50         
CCCCCCGCGAUCGAUCCC  -     C   C   --         -|  C      GUGACU 
                  GG CCCGG UGC UGG  GUUCCUGGC AUG UGAUUU      U
                  CC GGGCC ACG ACC  UAGGGACCG UAC ACUAAA      A
CCCUCCCGCCGCCCCCCG  A     U   C   AA         U^  -      AAGAGA 
 .       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Oan-Mir-23-P2_5p*

MirBase accessionMIMAT0006958
Sequence
0- UGGGUUCCUGGCAUGCUGAUUU -22
Get sequence
Mature sequence

Oan-Mir-23-P2_3p

MirBase accessionMIMAT0006959
Sequence
38- AUCACAUUGCCAGGGAUAACCAC -61
Get sequence