MirGeneDB

MirGeneDB ID

Dre-Mir-23-P2b

Family name MIR-23 (all species)
Seed UCACAUU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-23b-2
Paralogues Dre-Mir-23-P1  Dre-Mir-23-P2a  Dre-Mir-23-P3  Dre-Mir-23-P4 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr8: 30167636-30167695 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P2b)
Mir-24-P2b chr8: 30162533-30162589 [-] UCSC Ensembl
Mir-27-P2b chr8: 30167449-30167508 [-] UCSC Ensembl
Mir-23-P2b chr8: 30167636-30167695 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGCCUGGCCUUUCAUGCUGCUGGCUGUGUGGGUUCCUGGCGUGCUGAUUUGUGACUUAAGAUAAAAAUCACAUUGCCAGGGAUUACCACACAACCGCCACCCGGACGGCUGCUAUGCCA
Get precursor sequence
Structure
        10        20           30          40         50        
AGGCCUGGCCUUUCAUGCUGC    ---       --         -|  C      GUGACU 
                     UGGC   UGUGUGG  GUUCCUGGC GUG UGAUUU      U
                     ACCG   ACACACC  UAGGGACCG UAC ACUAAA      A
ACCGUAUCGUCGGCAGGCCC-    CCA       AU         U^  -      AAUAGA 
.       110        100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentFor many taxa there is often a higher set of 5p reads shifted -1 relative to what is annotated here. However the 5'moR reads support what is annotated here as the actual Drosha cut in relation to the phylogenetically conserved Group 2 3' arm.
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-23-P2b_5p*

MirBase accessionMIMAT0048660
Sequence
0- GGGUUCCUGGCGUGCUGAUUU -21
Get sequence
Mature sequence

Dre-Mir-23-P2b_3p

MirBase accessionMIMAT0048661
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence