MirGeneDB

MirGeneDB ID

Dre-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-23a-2
Paralogues Dre-Mir-23-P2a  Dre-Mir-23-P2b  Dre-Mir-23-P3  Dre-Mir-23-P4 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr3: 13406243-13406303 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P1)
Mir-23-P1 chr3: 13406243-13406303 [+] UCSC Ensembl
Mir-27-P1 chr3: 13406464-13406527 [+] UCSC Ensembl
Mir-24-P1 chr3: 13412992-13413050 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUCCAGACCCUCCUCUUCUGCCGGCCAGGGGAAUUCCUGGCAGAGUGAUUUUUAAACCUAAUGACUGAAUCACAUUGCCAGGGAUUUCCAAUGGCUCGUGUGACUCAGAGACACGCCAGA
Get precursor sequence
Structure
        10        20           30        40        50          
AAUCCAGACCCUCCUCUUCU  -  -    G-|              A       UUAAACC 
                    GC CG GCCA  GGGAAUUCCUGGCAG GUGAUUU       \
                    UG GC CGGU  CCUUUAGGGACCGUU CACUAAG       U
AGACCGCACAGAGACUCAG-  U  U    AA^              A       UCAGUAA 
 .       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-23-P1_5p*

MirBase accessionMIMAT0031944
Sequence
0- GGAAUUCCUGGCAGAGUGAUUU -22
Get sequence
Mature sequence

Dre-Mir-23-P1_3p

MirBase accessionMIMAT0001790
Sequence
39- AUCACAUUGCCAGGGAUUUCCA -61
Get sequence
Validated targets TargetScanFish: dre-miR-23a