MirGeneDB

MirGeneDB ID

Dre-Mir-24-P1

Family name MIR-24 (all species)
Seed GGCUCAG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-24-2
Paralogues Dre-Mir-24-P2a  Dre-Mir-24-P2b  Dre-Mir-24-P3  Dre-Mir-24-P4 
Orthologues Aca-Mir-24-P1  Ami-Mir-24-P1  Bta-Mir-24-P1  Cfa-Mir-24-P1  Cpi-Mir-24-P1  Cpo-Mir-24-P1  Dno-Mir-24-P1  Ete-Mir-24-P1  Hsa-Mir-24-P1  Mdo-Mir-24-P1  Mml-Mir-24-P1  Mmu-Mir-24-P1  Oan-Mir-24-P1  Ocu-Mir-24-P1  Rno-Mir-24-P1  Sha-Mir-24-P1  Sto-Mir-24-o1  Sto-Mir-24-P1  Xtr-Mir-24-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr3: 13412992-13413050 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P1)
Mir-23-P1 chr3: 13406243-13406303 [+] UCSC Ensembl
Mir-27-P1 chr3: 13406464-13406527 [+] UCSC Ensembl
Mir-24-P1 chr3: 13412992-13413050 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUGUGUUCUCCUCUGUGGGCUGGUCUCCUGUGCCUGCUGUGCUGAUAAUCAGUGGACGGCUGUGACUGGCUCAGUUCAGCAGGAACAGGGGCCUGGUCUUCUCUCUGUGGGCUUUUCA
Get precursor sequence
Structure
        10          20        30        40        50          
UGUGUGUUCUCCUCUGU--|   UG U       G       U     UAA     GGACG 
                   GGGC  G CUCCUGU CCUGCUG GCUGA   UCAGU     \
                   UCUG  C GGGGACA GGACGAC UGACU   GGUCA     G
ACUUUUCGGGUGUCUCUCU^   GU C       A       U     C--     GUGUC 
       110       100        90        80          70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site +1 on the 5p arm relative to what is annotated here.
3' NTU Yes
MotifsUG at 5p(-14)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-24-P1_5p*

MirBase accessionNone
Sequence
0- GUGCCUGCUGUGCUGAUAAUCAGU -24
Get sequence
Mature sequence

Dre-Mir-24-P1_3p

MirBase accessionMIMAT0001792
Sequence
37- UGGCUCAGUUCAGCAGGAACAG -59
Get sequence
Validated targets TargetScanFish: dre-miR-24