MirGeneDB

MirGeneDB ID

Dre-Mir-23-P3

Family name MIR-23 (all species)
Seed UCACAUU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-23a-1
Paralogues Dre-Mir-23-P1  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Dre-Mir-23-P4 
Orthologues Xtr-Mir-23-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr22: 5293226-5293289 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P3)
Mir-23-P3 chr22: 5293226-5293289 [+] UCSC Ensembl
Mir-27-P3 chr22: 5299972-5300035 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGGAGUGGGUGGUGCGGCUGUGGCGGGGAGGGUUCCUGGCACCGUGAUUUGGUGGAUAAACAGAAAUGAAAAUCACAUUGCCAGGGAUUUCCACUCCUGCACGGUUCUUCAGGUGCCCAAAAC
Get precursor sequence
Structure
        10         20         30          40        50        60 
CUGGAGUGGGUGGUGCG-     G     - A  --|         CC       GGUGGAUAA 
                  GCUGU GCGGG G GG  GUUCCUGGCA  GUGAUUU         \
                  UGGCA CGUCC C CC  UAGGGACCGU  CACUAAA         A
CAAAACCCGUGGACUUCU     -     U A  UU^         UA       AGUAAAGAC 
  120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-23-P3_5p*

MirBase accessionNone
Sequence
0- GGGUUCCUGGCACCGUGAUUU -21
Get sequence
Mature sequence

Dre-Mir-23-P3_3p

MirBase accessionMIMAT0001790
Sequence
42- AUCACAUUGCCAGGGAUUUCCA -64
Get sequence
Validated targets TargetScanFish: dre-miR-23a