MirGeneDB

MirGeneDB ID

Xtr-Mir-23-P3

Family name MIR-23 (all species)
Seed UCACAUU
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-23a-2
Paralogues Xtr-Mir-23-P1  Xtr-Mir-23-P2 
Orthologues Dre-Mir-23-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021653: 99901335-99901395 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-23-P3)
Mir-27-P3c KB021653: 99901045-99901106 [-] UCSC
Mir-27-P3d KB021653: 99901045-99901106 [-] UCSC
Mir-23-P3 KB021653: 99901335-99901395 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GUGACUCUAUUUUUCACUCUGUGGCUGGUAGGAUUCCUGGCAGAGUGAUUUGGAAAUGUAUGGUACAAAAUCACAUUGCCAGGGAUUUCCAAUCAGUCCCGGGCCAAUCAUCCUCCUCUUG
Get precursor sequence
Structure
        10         20        30          40        50         
GUGACUCUAUUUUUCAC-    U       A   --|         A       GGAAAUG 
                  UCUG GGCUGGU GGA  UUCCUGGCAG GUGAUUU       U
                  GGGC CUGACUA CCU  AGGGACCGUU CACUAAA       A
GUUCUCCUCCUACUAACC    C       A   UU^         A       ACAUGGU 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Em Em Em Em He
Star sequence

Xtr-Mir-23-P3_5p*

MirBase accessionNone
Sequence
0- GGAUUCCUGGCAGAGUGAUUU -21
Get sequence
Mature sequence

Xtr-Mir-23-P3_3p

MirBase accessionMIMAT0003568
Sequence
39- AUCACAUUGCCAGGGAUUUCCA -61
Get sequence
Validated targets TargetScanVert: xtr-miR-23a