MirGeneDB

MirGeneDB ID

Xtr-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-23b
Paralogues Xtr-Mir-23-P1  Xtr-Mir-23-P3 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021649: 90035547-90035606 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-24-P2 KB021649: 90034717-90034775 [-] UCSC
Mir-27-P2 KB021649: 90035317-90035379 [-] UCSC
Mir-23-P2 KB021649: 90035547-90035606 [-] UCSC
Precursor
(pre-Mir +30nt flank)
AAAAGUUUUGUAAUACCGGUGUGGCUGUUUGGGUUCCUGGCAUGCUGAUUUGUGAGUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACACAACCAUGUCCUUGGCGACUCGCAUGGAA
Get precursor sequence
Structure
        10          20        30          40         50        
AAAAGUUUUGUAAUACC-- GU    C   U   --         -|  C      GUGAGU 
                   G  GUGG UGU UGG  GUUCCUGGC AUG UGAUUU      U
                   C  UACC ACA ACC  UAGGGACCG UAC ACUAAA      A
AAGGUACGCUCAGCGGUUC UG    A   C   AU         U^  -      AUUAGA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Em Em Em Em He
Star sequence

Xtr-Mir-23-P2_5p*

MirBase accessionNone
Sequence
0- GGGUUCCUGGCAUGCUGAUUU -21
Get sequence
Mature sequence

Xtr-Mir-23-P2_3p

MirBase accessionMIMAT0003673
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence
Validated targets TargetScanVert: xtr-miR-23b