MirGeneDB

MirGeneDB ID

Bta-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Cow (Bos taurus)
MiRBase ID bta-mir-23b
Paralogues Bta-Mir-23-P1 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr8: 83009615-83009674 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-2475 chr8: 83008960-83009020 [+] UCSC Ensembl
Mir-23-P2 chr8: 83009615-83009674 [+] UCSC Ensembl
Mir-27-P2 chr8: 83009841-83009903 [+] UCSC Ensembl
Mir-24-P2 chr8: 83010382-83010441 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACCACCGCCCCCGAGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCCUGACUGCUGCUCCAGAA
Get precursor sequence
Structure
        10         20         30          40         50        
CACCACCGCCCCCGAGUGC-  -   C   U   --         -|  C      GUGACU 
                    UC UGG UGC UGG  GUUCCUGGC AUG UGAUUU      U
                    AG ACC ACG ACC  UAGGGACCG UAC ACUAAA      A
AAGACCUCGUCGUCAGUCCC  C   A   C   AU         U^  -      AUUAGA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-23-P2_5p*

MirBase accessionMIMAT0012538
Sequence
0- GGGUUCCUGGCAUGCUGAUUU -21
Get sequence
Validated targets TargetScanVert: bta-miR-23b-5p
Mature sequence

Bta-Mir-23-P2_3p

MirBase accessionMIMAT0003852
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence
Validated targets TargetScanVert: bta-miR-23b-3p