MirGeneDB

MirGeneDB ID

Hsa-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-23b
Paralogues Hsa-Mir-23-P1 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr9: 95085227-95085287 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-23-P2 chr9: 95085227-95085287 [+] UCSC Ensembl
Mir-27-P2 chr9: 95085463-95085525 [+] UCSC Ensembl
Mir-24-P2 chr9: 95086026-95086085 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGGCGCUGCUCUCAGGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGCUGCUCCUCCAGAA
Get precursor sequence
Structure
        10        20         30          40         50         
GUGGCGCUGCUCUCAGGUGC  -   C   U   --         -|  C      GUGACU 
                    UC UGG UGC UGG  GUUCCUGGC AUG UGAUUU      U
                    AG ACC ACG ACC  UAGGGACCG UAC ACUAAA      A
AAGACCUCCUCGUCGGUUCC  C   A   C   AU         U^  -      AUUAGA 
 .       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-23-P2_5p*

MirBase accessionMIMAT0004587
Sequence
0- UGGGUUCCUGGCAUGCUGAUUU -22
Get sequence
Validated targets microrna.org: MIMAT0004587
TargetScanVert: hsa-miR-23b-5p
TargetMiner: hsa-miR-23b-5p
miRDB: MIMAT0004587
Mature sequence

Hsa-Mir-23-P2_3p

MirBase accessionMIMAT0000418
Sequence
38- AUCACAUUGCCAGGGAUUACCAC -61
Get sequence
Validated targets microrna.org: MIMAT0000418
TargetScanVert: hsa-miR-23b-3p
TargetMiner: hsa-miR-23b-3p
miRDB: MIMAT0000418