MirGeneDB

MirGeneDB ID

Cpo-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-23b
Paralogues Cpo-Mir-23-P1 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(cavPor3)
scaffold_42: 4055809-4055868 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-24-P2 scaffold_42: 4055099-4055157 [-] UCSC
Mir-27-P2 scaffold_42: 4055574-4055636 [-] UCSC
Mir-23-P2 scaffold_42: 4055809-4055868 [-] UCSC
Precursor
(pre-Mir +30nt flank)
CAGCUCUGCUCCUGAGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACCACGACCUUGGCUGCUCCUCUGAAA
Get precursor sequence
Structure
        10         20         30          40         50        
CAGCUCUGCUCCUGAGUGC-  -   C   U   --         -|  C      GUGACU 
                    UC UGG UGC UGG  GUUCCUGGC AUG UGAUUU      U
                    AG ACC ACG ACC  UAGGGACCG UAC ACUAAA      A
AAAGUCUCCUCGUCGGUUCC  C   A   C   AU         U^  -      AUUAGA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Cpo-Mir-23-P2_5p*

MirBase accessionMIMAT0046878
Sequence
0- GGGUUCCUGGCAUGCUGAUUU -21
Get sequence
Mature sequence

Cpo-Mir-23-P2_3p

MirBase accessionMIMAT0046879
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence