MirGeneDB

MirGeneDB ID

Mdo-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Gray short-tailed opossum (Monodelphis domestica)
MiRBase ID mdo-mir-23b
Paralogues Mdo-Mir-23-P1 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(monDom5)
6: 17695908-17695968 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-23-P2 6: 17695908-17695968 [+] UCSC Ensembl
Mir-27-P2 6: 17696108-17696170 [+] UCSC Ensembl
Mir-24-P2 6: 17696509-17696568 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCGCCGGCUUUGUCGAGUGCUCUGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUGAAAAUCACAUUGCCAGGGAUUACCACGCAGCCAUGACCGUGGCUGCUCCCCCAGAA
Get precursor sequence
Structure
        10        20         30          40         50         
GCGCCGGCUUUGUCGAGU C  -       U   --         -|  C      GUGACU 
                  G UC UGGCUGC UGG  GUUCCUGGC AUG UGAUUU      U
                  C AG ACCGACG ACC  UAGGGACCG UAC ACUAAA      A
AAGACCCCCUCGUCGGUG C  U       C   AU         U^  -      AGUAGA 
 .       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Mdo-Mir-23-P2_5p*

MirBase accessionMIMAT0026713
Sequence
0- UGGGUUCCUGGCAUGCUGAUUU -22
Get sequence
Validated targets TargetScanVert: mdo-miR-23b-5p
Mature sequence

Mdo-Mir-23-P2_3p

MirBase accessionMIMAT0004176
Sequence
38- AUCACAUUGCCAGGGAUUACCAC -61
Get sequence
Validated targets TargetScanVert: mdo-miR-23b-3p