MirGeneDB

MirGeneDB ID

Ami-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-23b
Paralogues Ami-Mir-23-P1 
Orthologues Aca-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(allMis1)
JH734258: 394547-394606 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-23-P2 JH734258: 394547-394606 [+] UCSC
Mir-27-P2 JH734258: 394776-394838 [+] UCSC
Mir-24-P2 JH734258: 395350-395409 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CACAAGUGUUUCCCAGUGUUGUGGCUGUUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAAAUUAAAAUCACAUUGCCAGGGAUUACCACAGAGCCAUGACCAUGGCUGCUGUUAUGAAA
Get precursor sequence
Structure
        10          20        30          40         50        
CACAAGUGUUUCCCAGU--  UG     GUU   --         -|  C      GUGACU 
                   GU  UGGCU   UGG  GUUCCUGGC AUG UGAUUU      U
                   CA  ACCGA   ACC  UAGGGACCG UAC ACUAAA      A
AAAGUAUUGUCGUCGGUAC  GU     GAC   AU         U^  -      AUUAAA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Star sequence

Ami-Mir-23-P2_5p*

MirBase accessionMIMAT0038059
Sequence
0- GGGUUCCUGGCAUGCUGAUUU -21
Get sequence
Mature sequence

Ami-Mir-23-P2_3p

MirBase accessionMIMAT0038060
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence