MirGeneDB

MirGeneDB ID

Gga-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-23b
Paralogues
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpi-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
Z: 41649180-41649239 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-23-P2 Z: 41649180-41649239 [+] UCSC Ensembl
Mir-27-P2 Z: 41649420-41649482 [+] UCSC Ensembl
Mir-24-P2 Z: 41649940-41649999 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACAGCUUUCUUUUAAUGUUGUGGCUGUUUGGGUUCCUGGCAUGAUGAUUUGUGAGUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACAUAGCCAUGACCGCAGCUGCUACUCUGAAA
Get precursor sequence
Structure
        10          20        30          40         50        
CACAGCUUUCUUUUAAU--  UG       U   --         -|  A      GUGAGU 
                   GU  UGGCUGU UGG  GUUCCUGGC AUG UGAUUU      U
                   CA  ACCGAUA ACC  UAGGGACCG UAC ACUAAA      A
AAAGUCUCAUCGUCGACGC  GU       C   AU         U^  -      AUUAGA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-23-P2_5p*

MirBase accessionMIMAT0026546
Sequence
0- GGGUUCCUGGCAUGAUGAUUU -21
Get sequence
Validated targets TargetScanVert: gga-miR-23b-5p
miRDB: MIMAT0026546
Mature sequence

Gga-Mir-23-P2_3p

MirBase accessionMIMAT0001186
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence
Validated targets TargetScanVert: gga-miR-23b-3p
miRDB: MIMAT0001186