MirGeneDB

MirGeneDB ID

Gga-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-24
Paralogues
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
Z: 41649940-41649999 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P2)
Mir-23-P2 Z: 41649180-41649239 [+] UCSC Ensembl
Mir-27-P2 Z: 41649420-41649482 [+] UCSC Ensembl
Mir-24-P2 Z: 41649940-41649999 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUCCCGAGCAUGGAUGGACCCGUCCUCCGGUGCCUACUGAGCUGAUAUCAGUUCUGAUUUUACAUACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCUAGAGCAAAAAAAUAAAGA
Get precursor sequence
Structure
        10        20           30        40        50          
UGUCCCGAGCAUGGAUGGACC---| UC    G  G   A         UA     UCUGAU 
                        CG  CUCC GU CCU CUGAGCUGA  UCAGU      \
                        GC  GAGG CA GGA GACUUGACU  GGUCA      U
AGAAAUAAAAAAACGAGAUCCCGA^ U-    A  A   C         C-     UACAUU 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-24-P2_5p*

MirBase accessionMIMAT0026548
Sequence
0- GUGCCUACUGAGCUGAUAUCAGU -23
Get sequence
Validated targets TargetScanVert: gga-miR-24-5p
miRDB: MIMAT0026548
Mature sequence

Gga-Mir-24-P2_3p

MirBase accessionMIMAT0001188
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence
Validated targets TargetScanVert: gga-miR-24-3p
miRDB: MIMAT0001188