MirGeneDB

MirGeneDB ID

Oan-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-24-1
Paralogues Oan-Mir-24-P1 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dno-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041753.1: 69581866-69581924 [+]
Clustered MiRNAs
(< 10kb from Mir-24-P2)
Mir-23-P2 NC_041753.1: 69581117-69581177 [+]
Mir-27-P2 NC_041753.1: 69581278-69581340 [+]
Mir-24-P2 NC_041753.1: 69581866-69581924 [+]
Precursor
(pre-Mir +30nt flank)
CUGGGUCCGCGGAAUCGGACUGACCCUCCAGUGCCUACUGAGCUGAUAUCAGUUCUCGUUGACCCACUGGCUCAGUUCAGCAGGAACAGGAGUGCGGCCCACGUCCACCGAGGAGAUGC
Get precursor sequence
Structure
        10           20        30        40        50         
CUGGGUCCGCGGAAUCGGA---|  ACC    A  G   A         UA     UCUCG 
                      CUG   CUCC GU CCU CUGAGCUGA  UCAGU     U
                      GGC   GAGG CA GGA GACUUGACU  GGUCA     U
CGUAGAGGAGCCACCUGCACCC^  GU-    A  A   C         C-     CCCAG 
       110       100         90        80         70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 on the 5p arm relative to what is annotated here.
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Oan-Mir-24-P2_5p*

MirBase accessionMIMAT0006954
Sequence
0- GUGCCUACUGAGCUGAUAUCAGU -23
Get sequence
Mature sequence

Oan-Mir-24-P2_3p

MirBase accessionMIMAT0006955
Sequence
37- UGGCUCAGUUCAGCAGGAACAG -59
Get sequence