MirGeneDB

MirGeneDB ID

Cpo-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-24-1
Paralogues Cpo-Mir-24-P1 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Dno-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(cavPor3)
scaffold_42: 4055099-4055157 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-24-P2)
Mir-24-P2 scaffold_42: 4055099-4055157 [-] UCSC
Mir-27-P2 scaffold_42: 4055574-4055636 [-] UCSC
Mir-23-P2 scaffold_42: 4055809-4055868 [-] UCSC
Precursor
(pre-Mir +30nt flank)
UGCUCCGGCUGUCGUUGGACCCGCCCUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCUUGUACACACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCUUGAGCAAAGCCUCCCGUC
Get precursor sequence
Structure
        10        20           30        40        50         
UGCUCCGGCUGUCGUUGGACC---| CC    G  G   A         UA     UCUCU 
                        CG  CUCC GU CCU CUGAGCUGA  UCAGU     U
                        GC  GAGG CA GGA GACUUGACU  GGUCA     G
CUGCCCUCCGAAACGAGUUCCCGA^ U-    A  A   C         C-     CACAU 
       110       100         90        80         70        60
Deep sequencing
Go to detailed chart
CommentAlthough not well supported by deep read data all taxa sequenced in this study show the same read pattern and better and more deeply sequenced vertebrate taxa are all clearly Group 2 miRNAs suggesting that this too is likely a Group 2 miRNA.
3' NTU Yes
MotifsNo
Tissue expression
 +
To
Star sequence

Cpo-Mir-24-P2_5p*

MirBase accessionMIMAT0046880
Sequence
0- GUGCCUACUGAGCUGAUAUCAGU -23
Get sequence
Mature sequence

Cpo-Mir-24-P2_3p

MirBase accessionMIMAT0046881
Sequence
37- UGGCUCAGUUCAGCAGGAACAG -59
Get sequence