| MirGeneDB ID | Cpo-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-24 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Guinea pig (Cavia porcellus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cpo-mir-24-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cpo-Mir-24-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-24-P3 Ami-Mir-24-P3 Bta-Mir-24-P3 Cfa-Mir-24-P3 Cja-Mir-24-P3 Cmi-Mir-24-P3 Cpi-Mir-24-P3 Dno-Mir-24-P3 Dre-Mir-24-P3 Eca-Mir-24-P3 Ete-Mir-24-P3 Gga-Mir-24-P3 Gja-Mir-24-P3 Gmo-Mir-24-P3 Hsa-Mir-24-P3 Laf-Mir-24-P3 Lch-Mir-24-P3 Loc-Mir-24-P3 Mdo-Mir-24-P3 Mml-Mir-24-P3 Mmr-Mir-24-P3 Mmu-Mir-24-P3 Mun-Mir-24-P3a Mun-Mir-24-P3b Neu-Mir-24-P3 Oan-Mir-24-P3 Ocu-Mir-24-P3 Pab-Mir-24-P3 Pbv-Mir-24-P3 Rno-Mir-24-P3 Sha-Mir-24-P3 Sto-Mir-24-P3 Tgu-Mir-24-P3 Tni-Mir-24-P3 Xla-Mir-24-P3c Xla-Mir-24-P3d Xtr-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (cavPor3) |
scaffold_42: 12931984-12932043 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-24-P3) |
Mir-181-P1c
scaffold_42: 12912419-12912479 [-]
UCSC
Mir-23-P3 scaffold_42: 12931646-12931704 [+] UCSC Mir-27-P3 scaffold_42: 12931848-12931908 [+] UCSC Mir-24-P3 scaffold_42: 12931984-12932043 [+] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGCUCAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCACUACUGCUGGGCCGGGCUCUGCCUCCUGUACCUACUGAGCUGAAACACAGUUGAUUUGUGCAGACUGGCUCAGUUCAGCAGGAACAGGGGUCAAGUCCCCUGGAGCCCGCUGCUGGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CCACUACUGCUGGGCCG---| CU U A A AACA UGAUU GGCU GCC CCUGU CCU CUGAGCUGA CAGU U CUGA UGG GGACA GGA GACUUGACU GUCA G CGGUCGUCGCCCGAGGUCCC^ AC - A C CG-- GACGU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Although not well supported by deep read data all taxa sequenced in this study show the same read pattern and better and DcRNAe deeply sequenced vertebrate taxa are all clearly Group 2 miRNAs suggesting that this too is likely a Group 2 miRNA. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cpo-Mir-24-P3_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0046882 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUACCUACUGAGCUGAAACACAGU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cpo-Mir-24-P3_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0046881 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence
|
