| MirGeneDB ID | Gja-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-24 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-24-P3 Ami-Mir-24-P3 Bta-Mir-24-P3 Cfa-Mir-24-P3 Cja-Mir-24-P3 Cmi-Mir-24-P3 Cpi-Mir-24-P3 Cpo-Mir-24-P3 Dno-Mir-24-P3 Dre-Mir-24-P3 Eca-Mir-24-P3 Ete-Mir-24-P3 Gga-Mir-24-P3 Gmo-Mir-24-P3 Hsa-Mir-24-P3 Laf-Mir-24-P3 Lch-Mir-24-P3 Loc-Mir-24-P3 Mdo-Mir-24-P3 Mml-Mir-24-P3 Mmr-Mir-24-P3 Mmu-Mir-24-P3 Mun-Mir-24-P3a Mun-Mir-24-P3b Neu-Mir-24-P3 Oan-Mir-24-P3 Ocu-Mir-24-P3 Pab-Mir-24-P3 Pbv-Mir-24-P3 Rno-Mir-24-P3 Sha-Mir-24-P3 Sto-Mir-24-P3 Tgu-Mir-24-P3 Tni-Mir-24-P3 Xla-Mir-24-P3c Xla-Mir-24-P3d Xtr-Mir-24-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015175453.1: 135655-135714 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-24-P3) |
Mir-24-P3
NW_015175453.1: 135655-135714 [-]
Mir-27-P3 NW_015175453.1: 135915-135976 [-] Mir-23-P3 NW_015175453.1: 136216-136276 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGCUCAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
ACGCGACGGUCCUUCUGGGUUUCGACUCCCGUGCCUACUGAGCUGAUACUCAGUCGCUUUGAACACACUGGCUCAGUUCAGAAGGAACAGGAGGCAGGGCUAGGCCUCCCAGACGGCACAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 ACGCGACGGUCCUUCUG--| CGA C G A UAC CGCUU GGUUU CUCC GU CCU CUGAGCUGA UCAGU U UCGGG GAGG CA GGA GACUUGACU GGUCA G ACACGGCAGACCCUCCGGA^ ACG A A A C-- CACAA . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is likely a 1 nt mismatch at position 14 on the 3p arm between the source of the genome (G. japonicus) and the source of the reads (C. variegatus) accounting for the paucity of reads of the mature miRNA. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-24-P3_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUGCCUACUGAGCUGAUACUCAGU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-24-P3_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UGGCUCAGUUCAGAAGGAACAG -60
Get sequence
|
