MirGeneDB

MirGeneDB ID

Dno-Mir-24-P2

Family name MIR-24 (all species)
Seed GGCUCAG
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-24a
Paralogues Dno-Mir-24-P1 
Orthologues Aca-Mir-24-P2  Ami-Mir-24-P2  Bta-Mir-24-P2  Cfa-Mir-24-P2  Cpi-Mir-24-P2  Cpo-Mir-24-P2  Dre-Mir-24-P2a  Dre-Mir-24-P2b  Ete-Mir-24-P2  Gga-Mir-24-P2  Hsa-Mir-24-P2  Mdo-Mir-24-P2  Mml-Mir-24-P2  Mmu-Mir-24-P2  Oan-Mir-24-P2  Ocu-Mir-24-P2  Rno-Mir-24-P2  Sha-Mir-24-P2  Sto-Mir-24-o2  Sto-Mir-24-P2  Tgu-Mir-24-P2  Xtr-Mir-24-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH570415: 2090841-2090900 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P2)
Mir-23-P2 JH570415: 2090017-2090076 [+] UCSC Ensembl
Mir-27-P2 JH570415: 2090250-2090312 [+] UCSC Ensembl
Mir-24-P2 JH570415: 2090841-2090900 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCCGGGCUGUCGAUUGGACCCGUCCUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUCACACACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCUAGAGCAAAAAGACUUCCC
Get precursor sequence
Structure
        10        20           30        40        50          
CUCCGGGCUGUCGAUUGGACC---| UC    G  G   A         UA     UCUCAU 
                        CG  CUCC GU CCU CUGAGCUGA  UCAGU      \
                        GC  GAGG CA GGA GACUUGACU  GGUCA      U
CCCUUCAGAAAAACGAGAUCCCGA^ U-    A  A   C         C-     CACACU 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
CommentAlthough not well supported by deep read data all taxa sequenced in this study show the same read pattern and better and more deeply sequenced vertebrate taxa are all clearly Group 2 miRNAs suggesting that this too is likely a Group 2 miRNA.
3' NTU Yes
MotifsNo
Tissue expression
 +
To
Star sequence

Dno-Mir-24-P2_5p*

MirBase accessionMIMAT0047532
Sequence
0- GUGCCUACUGAGCUGAUAUCAGU -23
Get sequence
Mature sequence

Dno-Mir-24-P2_3p

MirBase accessionMIMAT0047533
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence