MirGeneDB

MirGeneDB ID

Cpi-Mir-23-P2

Family name MIR-23 (all species)
Seed UCACAUU
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-23b
Paralogues Cpi-Mir-23-P1 
Orthologues Aca-Mir-23-P2  Ami-Mir-23-P2  Bta-Mir-23-P2  Cfa-Mir-23-P2  Cli-Mir-23-P2  Cpo-Mir-23-P2  Dno-Mir-23-P2  Dre-Mir-23-P2a  Dre-Mir-23-P2b  Ete-Mir-23-P2  Gga-Mir-23-P2  Hsa-Mir-23-P2  Mdo-Mir-23-P2  Mml-Mir-23-P2  Mmu-Mir-23-P2  Oan-Mir-23-P2  Ocu-Mir-23-P2  Rno-Mir-23-P2  Sha-Mir-23-P2  Sto-Mir-23-o2  Sto-Mir-23-P2  Tgu-Mir-23-P2  Xtr-Mir-23-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(chrPic1)
JH584764: 1109160-1109219 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-23-P2)
Mir-24-P2 JH584764: 1108440-1108499 [-] UCSC
Mir-27-P2 JH584764: 1108949-1109011 [-] UCSC
Mir-23-P2 JH584764: 1109160-1109219 [-] UCSC
Precursor
(pre-Mir +30nt flank)
CACAAGUGUCCCUUAAUGUUGUGGCUGUUUGGGUUCCUGGCAUGCUGAUUUGUGAUUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACAUAACCAUGACUGUGCCUCCUAUUAUGAAA
Get precursor sequence
Structure
        10          20        30          40         50        
CACAAGUGUCCCUUAAU--  UG   C   U   --         -|  C      GUGAUU 
                   GU  UGG UGU UGG  GUUCCUGGC AUG UGAUUU      U
                   CA  ACC AUA ACC  UAGGGACCG UAC ACUAAA      A
AAAGUAUUAUCCUCCGUGU  GU   A   C   AU         U^  -      AUUAGA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Te Te Te To
Star sequence

Cpi-Mir-23-P2_5p*

MirBase accessionNone
Sequence
0- GGGUUCCUGGCAUGCUGAUUU -21
Get sequence
Mature sequence

Cpi-Mir-23-P2_3p

MirBase accessionMIMAT0037656
Sequence
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence