MirGeneDB

MirGeneDB ID

Mdo-Mir-27-P2

Family name MIR-27 (all species)
Seed UCACAGU
Species Gray short-tailed opossum (Monodelphis domestica)
MiRBase ID mdo-mir-27b
Paralogues Mdo-Mir-27-P1 
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Dre-Mir-27-P2a  Dre-Mir-27-P2b  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Oan-Mir-27-P2  Ocu-Mir-27-P2  Rno-Mir-27-P2  Sha-Mir-27-P2  Sto-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(monDom5)
6: 17696108-17696170 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P2)
Mir-23-P2 6: 17695908-17695968 [+] UCSC Ensembl
Mir-27-P2 6: 17696108-17696170 [+] UCSC Ensembl
Mir-24-P2 6: 17696509-17696568 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUCGGAGGACGACCUCUCUGACAAGGUGCAGAGCUUAGCCGAUUGGUGAACAGUCACUGAUUUCCUCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGGGAGAUGGGACGUCUG
Get precursor sequence
Structure
        10            20        30        40        50        60  
GCUCGGAGGACGACCUC----|  GACA                  AUUG       GUCACUGA 
                     UCU    AGGUGCAGAGCUUAGCCG    GUGAACA        \
                     AGA    UCCACGUCUUGAAUCGGU    CACUUGU        U
GUCUGCAGGGUAGAGGGGAAG^  AG--                  GA--       UUCUCCUU 
 120       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Mdo-Mir-27-P2_5p*

MirBase accessionMIMAT0026714
Sequence
0- AGAGCUUAGCCGAUUGGUGAACA -23
Get sequence
Validated targets TargetScanVert: mdo-miR-27b-5p
Mature sequence

Mdo-Mir-27-P2_3p

MirBase accessionMIMAT0004177
Sequence
42- UUCACAGUGGCUAAGUUCUGC -63
Get sequence
Validated targets TargetScanVert: mdo-miR-27b-3p