MirGeneDB

MirGeneDB ID

Mmu-Mir-27-P2

Family name MIR-27 (all species)
Seed UCACAGU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-27b
Paralogues Mmu-Mir-27-P1 
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Dre-Mir-27-P2a  Dre-Mir-27-P2b  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Oan-Mir-27-P2  Ocu-Mir-27-P2  Rno-Mir-27-P2  Sha-Mir-27-P2  Sto-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr13: 63300718-63300780 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P2)
Mir-23-P2 chr13: 63300492-63300551 [+] UCSC Ensembl
Mir-27-P2 chr13: 63300718-63300780 [+] UCSC Ensembl
Mir-24-P2 chr13: 63301213-63301272 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGCCGGCGAUGACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUGAGAUGGGGACAGUU
Get precursor sequence
Structure
        10          20        30        40        50        60  
UGGCCGGCGAUGACCUC--|  AACA                  AUUG       GUGAUUGG 
                   UCU    AGGUGCAGAGCUUAGCUG    GUGAACA        \
                   AGA    UCCACGUCUUGAAUCGGU    CACUUGU        U
UUGACAGGGGUAGAGUGGA^  GAAG                  GA--       UUCGCCUU 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-27-P2_5p*

MirBase accessionMIMAT0004522
Sequence
0- AGAGCUUAGCUGAUUGGUGAACA -23
Get sequence
Validated targets microrna.org: MIMAT0004522
TargetScanVert: mmu-miR-27b-5p
miRDB: MIMAT0004522
Mature sequence

Mmu-Mir-27-P2_3p

MirBase accessionMIMAT0000126
Sequence
42- UUCACAGUGGCUAAGUUCUGC -63
Get sequence
Validated targets microrna.org: MIMAT0000126
TargetScanVert: mmu-miR-27b-3p
miRDB: MIMAT0000126