MirGeneDB

MirGeneDB ID

Rno-Mir-27-P2

Family name MIR-27 (all species)
Seed UCACAGU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-27b
Paralogues Rno-Mir-27-P1 
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Dre-Mir-27-P2a  Dre-Mir-27-P2b  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Oan-Mir-27-P2  Ocu-Mir-27-P2  Sha-Mir-27-P2  Sto-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr17: 823479-823541 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P2)
Mir-23-P2 chr17: 823242-823301 [+] UCSC Ensembl
Mir-27-P2 chr17: 823479-823541 [+] UCSC Ensembl
Mir-24-P2 chr17: 823973-824032 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGCCGGCGAUGACCUCUCUAACAAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAAGAGAAGGUGAGAUGGGGACAGUU
Get precursor sequence
Structure
        10          20        30        40        50        60  
UGGCCGGCGAUGACCUC--|  AACA                  AUUG       GUGAUUGG 
                   UCU    AGGUGCAGAGCUUAGCUG    GUGAACA        \
                   AGA    UCCACGUCUUGAAUCGGU    CACUUGU        U
UUGACAGGGGUAGAGUGGA^  GAAG                  GA--       UUCGCCUU 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-27-P2_5p*

MirBase accessionMIMAT0017101
Sequence
0- AGAGCUUAGCUGAUUGGUGAACA -23
Get sequence
Validated targets TargetScanVert: rno-miR-27b-5p
miRDB: MIMAT0017101
Mature sequence

Rno-Mir-27-P2_3p

MirBase accessionMIMAT0000798
Sequence
42- UUCACAGUGGCUAAGUUCUGC -63
Get sequence
Validated targets microrna.org: MIMAT0000798
TargetScanVert: rno-miR-27b-3p
miRDB: MIMAT0000798