MirGeneDB

MirGeneDB ID

Cli-Mir-27-P2

Family name MIR-27 (all species)
Seed UCACAGU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-27b
Paralogues
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Dre-Mir-27-P2a  Dre-Mir-27-P2b  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Oan-Mir-27-P2  Ocu-Mir-27-P2  Rno-Mir-27-P2  Sha-Mir-27-P2  Sto-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold226: 157004-157066 [+]
Clustered MiRNAs
(< 10kb from Mir-27-P2)
Mir-23-P2 scaffold226: 156772-156831 [+]
Mir-27-P2 scaffold226: 157004-157066 [+]
Precursor
(pre-Mir +30nt flank)
ACCGAGACGGAGACCUCUCUGGCGAGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGUUUCCCUCUUUGUUCACAGUGGCUAAGUUCUGCACCUGAGGAGAAGGGGAGAGGAGACUUUGC
Get precursor sequence
Structure
        10            20        30        40        50        60  
ACCGAGACGGAGACCUC----|  GG G                  AUUG       GUGAUUGU 
                     UCU  C AGGUGCAGAGCUUAGCUG    GUGAACA        \
                     AGG  G UCCACGUCUUGAAUCGGU    CACUUGU        U
CGUUUCAGAGGAGAGGGGAAG^  A- -                  GA--       UUCUCCCU 
 120       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Cli-Mir-27-P2_5p*

MirBase accessionMIMAT0038445
Sequence
0- AGAGCUUAGCUGAUUGGUGAACA -23
Get sequence
Mature sequence

Cli-Mir-27-P2_3p

MirBase accessionMIMAT0038446
Sequence
42- UUCACAGUGGCUAAGUUCUGC -63
Get sequence