MirGeneDB

MirGeneDB ID

Bta-Mir-2475

Family name MIR-2475 (all species)
Seed GAAGUGU
Species Cow (Bos taurus)
MiRBase ID bta-mir-2475
Paralogues
Orthologues
Node of Origin (locus) B. taurus
Node of Origin (family) B. taurus
Genome context
(bosTau8)
chr8: 83008960-83009020 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-2475)
Mir-2475 chr8: 83008960-83009020 [+] UCSC Ensembl
Mir-23-P2 chr8: 83009615-83009674 [+] UCSC Ensembl
Mir-27-P2 chr8: 83009841-83009903 [+] UCSC Ensembl
Mir-24-P2 chr8: 83010382-83010441 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAGACAGUGAUCAGUGCCAGUCAUGUUUCUCUUCAGGUUUGCCACUUCACAGAGAGUUUGUGUUGCUUGAAGUGUGUGAAACUGCAGCGGUGCAGGCUGUGCCUUUGAUGUUCCCUGUGC
Get precursor sequence
Structure
        10           20        30        40         50         
UCAGACAGUGAUCAGUGC---|    A   U  U  U   G  UG -       CAGAGAGU 
                     CAGUC UGU UC CU CAG UU  C CACUUCA        U
                     GUCGG ACG GG GA GUC AA  G GUGAAGU        U
CGUGUCCCUUGUAGUUUCCGU^    -   U  C  C   A  GU U       UCGUUGUG 
 .       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-2475_5p*

MirBase accessionNone
Sequence
0- UCUUCAGGUUUGCCACUUCACA -22
Get sequence
Mature sequence

Bta-Mir-2475_3p

MirBase accessionMIMAT0012066
Sequence
38- UGAAGUGUGUGAAACUGCAGCGG -61
Get sequence
Validated targets TargetScanVert: bta-miR-2475