MirGeneDB

MirGeneDB ID

Sto-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-23-o1  Sto-Mir-23-o2  Sto-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Ami-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01001728.1: 158876-158934 [-]
Precursor
(pre-Mir +30nt flank)
ACUGCAAGAUAUUGCUUGCUGUGGCUGGCUGGGUUCCUGGCAGAGUGAUUUGAUUUAAUAAUGUAAAAUCACAUUGCCAGGGAUUACCAACCUGUCACCAGCUUUUACCAACCACUCCU
Get precursor sequence
Structure
        10        20         30          40        50        
ACUGCAAGAUAUUGCUUG  -     U  C   --|          A       GAUUUA 
                  CU GUGGC GG UGG  GUUCCUGGCAG GUGAUUU      A
                  GA CACUG CC ACC  UAGGGACCGUU CACUAAA      U
UCCUCACCAACCAUUUUC  C     U  A   AU^          A       AUGUAA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Sto-Mir-23-P1_5p*

MirBase accessionNone
Sequence
0- GGGUUCCUGGCAGAGUGAUUU -21
Get sequence
Mature sequence

Sto-Mir-23-P1_3p

MirBase accessionNone
Sequence
37- AUCACAUUGCCAGGGAUUACCA -59
Get sequence