MirGeneDB

MirGeneDB ID

Rno-Mir-210

Family name MIR-210 (all species)
Seed UGUGCGU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-210
Paralogues
Orthologues Aae-Mir-210-v1  Aae-Mir-210-v2  Aca-Mir-210  Ami-Mir-210  Bfl-Mir-210  Bge-Mir-210-v1  Bge-Mir-210-v2  Bta-Mir-210  Cfa-Mir-210  Cgi-Mir-210  Cli-Mir-210  Cpi-Mir-210  Cpo-Mir-210  Cte-Mir-210-P5  Cte-Mir-210-P6  Dan-Mir-210-v1  Dan-Mir-210-v2  Dme-Mir-210-v1  Dme-Mir-210-v2  Dmo-Mir-210-v1  Dmo-Mir-210-v2  Dno-Mir-210  Dpu-Mir-210  Dre-Mir-210  Efe-Mir-210  Ete-Mir-210  Gga-Mir-210  Hme-Mir-210-P3  Hme-Mir-210-P4  Hsa-Mir-210  Isc-Mir-210  Lan-Mir-210  Lgi-Mir-210  Mdo-Mir-210  Mml-Mir-210  Mmu-Mir-210  Oan-Mir-210  Ocu-Mir-210  Pfl-Mir-210  Pmi-Mir-210  Sha-Mir-210  Sko-Mir-210  Spu-Mir-210-v1  Spu-Mir-210-v2  Sto-Mir-210-P1  Sto-Mir-210-P2  Tca-Mir-210-v1  Tca-Mir-210-v2  Tgu-Mir-210  Xtr-Mir-210 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(rn6)
chr1: 214208378-214208437 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCACCGGGGCAGUCCCUCCAGGCUCAGGACAGCCACUGCCCACAGCACACUGCGUUGCUCCGGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUCCCUGGGCAGCGCGAACCCCUGGCC
Get precursor sequence
Structure
        10          20        30        40         50         
CCACCGGGGCAGUCCCU--|    CU    A     A   CC    -     C  CGUUGC 
                   CCAGG  CAGG CAGCC CUG  CACA GCACA UG      U
                   GGUCC  GUCU GUCGG GAC  GUGU CGUGU AC      C
CCGGUCCCCAAGCGCGACG^    CU    A     C   A-    G     C  CCAGGC 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-210_5p*

MirBase accessionMIMAT0017156
Sequence
0- AGCCACUGCCCACAGCACACUG -22
Get sequence
Validated targets TargetScanVert: rno-miR-210-5p
miRDB: MIMAT0017156
Mature sequence

Rno-Mir-210_3p

MirBase accessionMIMAT0000881
Sequence
38- CUGUGCGUGUGACAGCGGCUGA -60
Get sequence
Validated targets microrna.org: MIMAT0000881
TargetScanVert: rno-miR-210-3p
miRDB: MIMAT0000881