MirGeneDB

MirGeneDB ID

Isc-Mir-210

Family name MIR-210 (all species)
Seed AGUCGCU
Species Deer tick (Ixodes scapularis)
MiRBase ID
Paralogues
Orthologues Aae-Mir-210-v1  Aae-Mir-210-v2  Aca-Mir-210  Ami-Mir-210  Bfl-Mir-210  Bge-Mir-210-v1  Bge-Mir-210-v2  Bta-Mir-210  Cfa-Mir-210  Cgi-Mir-210  Cli-Mir-210  Cpi-Mir-210  Cpo-Mir-210  Cte-Mir-210-P5  Cte-Mir-210-P6  Dan-Mir-210-v1  Dan-Mir-210-v2  Dme-Mir-210-v1  Dme-Mir-210-v2  Dmo-Mir-210-v1  Dmo-Mir-210-v2  Dno-Mir-210  Dpu-Mir-210  Dre-Mir-210  Efe-Mir-210  Ete-Mir-210  Gga-Mir-210  Hme-Mir-210-P3  Hme-Mir-210-P4  Hsa-Mir-210  Lan-Mir-210  Lgi-Mir-210  Mdo-Mir-210  Mml-Mir-210  Mmu-Mir-210  Oan-Mir-210  Ocu-Mir-210  Pfl-Mir-210  Pmi-Mir-210  Rno-Mir-210  Sha-Mir-210  Sko-Mir-210  Spu-Mir-210-v1  Spu-Mir-210-v2  Sto-Mir-210-P1  Sto-Mir-210-P2  Tca-Mir-210-v1  Tca-Mir-210-v2  Tgu-Mir-210  Xtr-Mir-210 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS908024: 24478-24538 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CGACUACGAGACUUACGGCACCCUGACGAGCAGUCGCUGGCCAUGUCACAAGAGCGGAAUUGACUUUCUUGUGCGUGUGACAGCGGCUAUUGGGGAGUGCUCACAACGUCGUCGACCGNNN
Get precursor sequence
Structure
        10            20         30        40         50          
CGACUACGAGACUUACG----    -|  GA   GC        GC-    U       GCGGAA 
                     GCAC CCU  CGA  AGUCGCUG   CAUG CACAAGA      \
                     CGUG GGG  GUU  UCGGCGAC   GUGC GUGUUCU      U
NNNGCCAGCUGCUGCAACACU    A^  --   A-        AGU    -       UUCAGU 
 .       110       100          90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-210_5p

MirBase accessionNone
Sequence
0- CAGUCGCUGGCCAUGUCACAAGA -23
Get sequence
Star sequence

Isc-Mir-210_3p*

MirBase accessionNone
Sequence
38- UUGUGCGUGUGACAGCGGCUAUU -61
Get sequence