MirGeneDB

MirGeneDB ID

Lgi-Mir-210

Family name MIR-210 (all species)
Seed UGUGCGU
Species Owl limpet (Lottia gigantea)
MiRBase ID
Paralogues
Orthologues Aae-Mir-210-v1  Aae-Mir-210-v2  Aca-Mir-210  Ami-Mir-210  Bfl-Mir-210  Bge-Mir-210-v1  Bge-Mir-210-v2  Bta-Mir-210  Cfa-Mir-210  Cgi-Mir-210  Cli-Mir-210  Cpi-Mir-210  Cpo-Mir-210  Cte-Mir-210-P5  Cte-Mir-210-P6  Dan-Mir-210-v1  Dan-Mir-210-v2  Dme-Mir-210-v1  Dme-Mir-210-v2  Dmo-Mir-210-v1  Dmo-Mir-210-v2  Dno-Mir-210  Dpu-Mir-210  Dre-Mir-210  Efe-Mir-210  Ete-Mir-210  Gga-Mir-210  Hme-Mir-210-P3  Hme-Mir-210-P4  Hsa-Mir-210  Isc-Mir-210  Lan-Mir-210  Mdo-Mir-210  Mml-Mir-210  Mmu-Mir-210  Oan-Mir-210  Ocu-Mir-210  Pfl-Mir-210  Pmi-Mir-210  Rno-Mir-210  Sha-Mir-210  Sko-Mir-210  Spu-Mir-210-v1  Spu-Mir-210-v2  Sto-Mir-210-P1  Sto-Mir-210-P2  Tca-Mir-210-v1  Tca-Mir-210-v2  Tgu-Mir-210  Xtr-Mir-210 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_145: 563724-563779 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUGAAAGAUUUAUGAAUUCCGUGUUCCACUGGACGCAGUUUUACGCACUUACAUAAAUAAAGUGUUGUGCGUGGGACAGCGAUCGAUGGUGCACUGGUAAAUCGACAUAUUAUAUA
Get precursor sequence
Structure
        10         20         30        40        50        
UUGAAAGAUUUAUGAAUU-  -|   U   C   A   A           UU   UAAA 
                   CC GUGU CCA UGG CGC GUUUUACGCAC  ACA    \
                   GG CACG GGU GCU GCG CAGGGUGCGUG  UGU    U
AUAUAUUAUACAGCUAAAU  U^   U   A   A   A           U-   GAAA 
    110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-210_5p* (predicted)

MirBase accessionNone
Sequence
0- GGACGCAGUUUUACGCACUUACA -23
Get sequence
Mature sequence

Lgi-Mir-210_3p

MirBase accessionNone
Sequence
34- UUGUGCGUGGGACAGCGAUCGA -56
Get sequence