MirGeneDB

MirGeneDB ID

Spu-Mir-210-v1

Family name MIR-210 (all species)
Seed UUGUGCG
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-210
Paralogues Spu-Mir-210-v2 
Orthologues Aae-Mir-210-v1  Aca-Mir-210  Ami-Mir-210  Bfl-Mir-210  Bge-Mir-210-v1  Bta-Mir-210  Cfa-Mir-210  Cgi-Mir-210  Cli-Mir-210  Cpi-Mir-210  Cpo-Mir-210  Dan-Mir-210-v1  Dme-Mir-210-v1  Dmo-Mir-210-v1  Dno-Mir-210  Dpu-Mir-210  Dre-Mir-210  Efe-Mir-210  Ete-Mir-210  Gga-Mir-210  Hsa-Mir-210  Isc-Mir-210  Lan-Mir-210  Lgi-Mir-210  Mdo-Mir-210  Mml-Mir-210  Mmu-Mir-210  Oan-Mir-210  Ocu-Mir-210  Pfl-Mir-210  Pmi-Mir-210  Rno-Mir-210  Sha-Mir-210  Sko-Mir-210  Tca-Mir-210-v1  Tgu-Mir-210  Xtr-Mir-210 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold554: 214108-214172 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-210-v1)
Mir-210-v2 Scaffold554: 214107-214173 [+] Ensembl
Mir-210-v1 Scaffold554: 214108-214172 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCCUUAUCAACAUACCCAGCUCUCUCGUUAGUUGCUGUCACGCGGCACAAGAGAGCAAUCAUGUCUAUACACUCUUGUGCGUGCGACAGCGACUGAUACAGGGCUCCCUUUCAUCUGUGUUUACC
Get precursor sequence
Structure
        10           20        30        40        50        60  
GCCUUAUCAACAUACCC---|     CUC             A    G        AGCAAUCA 
                    AGCUCU   GUUAGUUGCUGUC CGCG CACAAGAG        U
                    UCGGGA   UAGUCAGCGACAG GUGC GUGUUCUC        G
CCAUUUGUGUCUACUUUCCC^     CA-             C    -        ACAUAUCU 
   120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-210-v1_5p* (predicted)

MirBase accessionNone
Sequence
0- GUUGCUGUCACGCGGCACAAGAG -23
Get sequence
Mature sequence

Spu-Mir-210-v1_3p

MirBase accessionMIMAT0009646
Sequence
43- CUUGUGCGUGCGACAGCGACUG -65
Get sequence