MirGeneDB

MirGeneDB ID

Oan-Mir-210

Family name MIR-210 (all species)
Seed UGUGCGU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID
Paralogues
Orthologues Aae-Mir-210-v1  Aae-Mir-210-v2  Aca-Mir-210  Ami-Mir-210  Bfl-Mir-210  Bge-Mir-210-v1  Bge-Mir-210-v2  Bta-Mir-210  Cfa-Mir-210  Cgi-Mir-210  Cli-Mir-210  Cpi-Mir-210  Cpo-Mir-210  Cte-Mir-210-P5  Cte-Mir-210-P6  Dan-Mir-210-v1  Dan-Mir-210-v2  Dme-Mir-210-v1  Dme-Mir-210-v2  Dmo-Mir-210-v1  Dmo-Mir-210-v2  Dno-Mir-210  Dpu-Mir-210  Dre-Mir-210  Efe-Mir-210  Ete-Mir-210  Gga-Mir-210  Hme-Mir-210-P3  Hme-Mir-210-P4  Hsa-Mir-210  Isc-Mir-210  Lan-Mir-210  Lgi-Mir-210  Mdo-Mir-210  Mml-Mir-210  Mmu-Mir-210  Ocu-Mir-210  Pfl-Mir-210  Pmi-Mir-210  Rno-Mir-210  Sha-Mir-210  Sko-Mir-210  Spu-Mir-210-v1  Spu-Mir-210-v2  Sto-Mir-210-P1  Sto-Mir-210-P2  Tca-Mir-210-v1  Tca-Mir-210-v2  Tgu-Mir-210  Xtr-Mir-210 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041730.1: 4083954-4084014 [+]
Precursor
(pre-Mir +30nt flank)
CGGCCGGGCCGGCCCCUCCAGGAGCAGGACAGCCACUGACUAACGCACAUUGUGCUGUUGGCGACGCCACUGUGCGUGUGACAGCGGCUAACCUGGCCCUCGGACACCAGCAGCGCCCGCC
Get precursor sequence
Structure
        10          20        30        40        50          
CGGCCGGGCCGGCCCCU-  -|  AG    AC    A   ACUA       U  UGCUGUU 
                  CC AGG  CAGG  AGCC CUG    ACGCACA UG       \
                  GG UCC  GUCC  UCGG GAC    UGCGUGU AC       G
CCGCCCGCGACGACCACA  C^  CG    AA    C   AGUG       C  CGCAGCG 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Star sequence

Oan-Mir-210_5p*

MirBase accessionNone
Sequence
0- AGCCACUGACUAACGCACAUUG -22
Get sequence
Mature sequence

Oan-Mir-210_3p

MirBase accessionNone
Sequence
39- CUGUGCGUGUGACAGCGGCUAA -61
Get sequence