MirGeneDB

MirGeneDB ID

Sto-Mir-210-P1

Family name MIR-210 (all species)
Seed UGUGCGU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-210-P2 
Orthologues Aca-Mir-210  Ami-Mir-210  Bfl-Mir-210  Bta-Mir-210  Cfa-Mir-210  Cgi-Mir-210  Cli-Mir-210  Cpi-Mir-210  Cpo-Mir-210  Dno-Mir-210  Dpu-Mir-210  Dre-Mir-210  Efe-Mir-210  Ete-Mir-210  Gga-Mir-210  Hsa-Mir-210  Isc-Mir-210  Lan-Mir-210  Lgi-Mir-210  Mdo-Mir-210  Mml-Mir-210  Mmu-Mir-210  Oan-Mir-210  Ocu-Mir-210  Pfl-Mir-210  Pmi-Mir-210  Rno-Mir-210  Sha-Mir-210  Sko-Mir-210  Tgu-Mir-210  Xtr-Mir-210 
Node of Origin (locus) S. torazame
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01030961.1: 3915-3974 [-]
Precursor
(pre-Mir +30nt flank)
CCACAGACUCACUCACUCCAGGGGUAGGUGAGCCACUGACCCAUGCACAUUGUGCUUUCUCUGACCAACUGUGCGUGUGACAGCGGCUAACUUGCUUUUAGGACAACAACAAUUGGGAGA
Get precursor sequence
Structure
        10          20        30        40         50         
CCACAGACUCACUCACU-  -          G    A   ACC        -|  UGCUUU 
                  CC AGGGGUAGGU AGCC CUG   CAUGCACA UUG      \
                  GG UUUUCGUUCA UCGG GAC   GUGCGUGU AAC      C
AGAGGGUUAACAACAACA  A          A    C   AGU        C^  CAGUCU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-210-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- AGCCACUGACCCAUGCACAUUG -22
Get sequence
Mature sequence

Sto-Mir-210-P1_3p

MirBase accessionNone
Sequence
38- CUGUGCGUGUGACAGCGGCUAA -60
Get sequence