MirGeneDB

MirGeneDB ID

Spu-Mir-2001

Family name MIR-2001 (all species)
Seed UGUGACC
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-2001
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold1276: 110932-110992 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2001)
Mir-2001 Scaffold1276: 110932-110992 [+] Ensembl
Mir-252-P2 Scaffold1276: 117467-117526 [+] Ensembl
Mir-252-P1 Scaffold1276: 118845-118928 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUUCAACAUACAUCACGUGAUCUUGUCAAUGUGACCGAUAUAAUGGGCAUGAAUAAUCAUGAUCAAUGUCCAGUAUAGCGGUGACAAUGAGAUGGUCAUGUGGUCAUCAGACAAACAAU
Get precursor sequence
Structure
        10          20        30        40        50          
AUAUUCAACAUACAUCA--|      UUG   A   G    A    A       GAAUAAU 
                   CGUGAUC   UCA UGU ACCG UAUA UGGGCAU       \
                   GUACUGG   AGU ACA UGGC AUAU ACCUGUA       C
UAACAAACAGACUACUGGU^      UAG   A   G    G    G       ACUAGUA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer cut -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-2001_5p

MirBase accessionMIMAT0009740
Sequence
0- AUGUGACCGAUAUAAUGGGCAU -22
Get sequence
Star sequence

Spu-Mir-2001_3p*

MirBase accessionNone
Sequence
39- GUCCAGUAUAGCGGUGACAAUG -61
Get sequence