MirGeneDB

MirGeneDB ID

Dan-Mir-2001

Family name MIR-2001 (all species)
Seed UUGUGAC
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-274
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13337: 5918636-5918702 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUUAAAAAACAGAAAUGUUGCAGUUUCGUUUUGUGACCGACACUAACGGGUAUUUUACAGGACAUACAGGAUUACUCGUUUUUGCGAUCACAAAUCCUGAAAUUGCAGCAAAAAACAGCAAAGAAA
Get precursor sequence
Structure
        10        20        30          40        50        60   
UUUUAAAAAACAGAAAUG           U--|      C  A  CU        UUUUACAGG 
                  UUGCAGUUUCG   UUUGUGA CG CA  AACGGGUA         A
                  GACGUUAAAGU   AAACACU GC GU  UUGCUCAU         C
AAAGAAACGACAAAAAAC           CCU^      A  -  UU        UAGGACAUA 
     120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-2001_5p

MirBase accessionMIMAT0008448
Sequence
0- UUUGUGACCGACACUAACGGGUA -23
Get sequence
Star sequence

Dan-Mir-2001_3p*

MirBase accessionNone
Sequence
45- CUCGUUUUUGCGAUCACAAAUC -67
Get sequence