MirGeneDB

MirGeneDB ID

Lgi-Mir-2001

Family name MIR-2001 (all species)
Seed UGUGACC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-2001
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_150: 486301-486357 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2001)
Mir-252-P1 LOTGIsca_150: 483957-484016 [-] Ensembl
Mir-252-P2 LOTGIsca_150: 486133-486191 [-] Ensembl
Mir-2001 LOTGIsca_150: 486301-486357 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AACGAGACAAAAGUAGAUGUACCGUGACCUUUGUGACCGUUAUAAUGGGCAUUUAGAAUUGAAGUGCUCCUUAUUACGAUCAGAAGGGUCUCGUUCCUUUAUAUCAUCAUCAGAAGU
Get precursor sequence
Structure
        10        20          30        40        50        
AACGAGACAAAAGUAGAUGUAC--| U       G   C   U    U       UAGA 
                        CG GACCUUU UGA CGU AUAA GGGCAUU    \
                        GC CUGGGAA ACU GCA UAUU CUCGUGA    A
UGAAGACUACUACUAUAUUUCCUU^ U       G   A   U    C       AGUU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-2001_5p

MirBase accessionMIMAT0009731
Sequence
0- UUGUGACCGUUAUAAUGGGCAUU -23
Get sequence
Star sequence

Lgi-Mir-2001_3p* (predicted)

MirBase accessionNone
Sequence
34- UGCUCCUUAUUACGAUCAGAAGG -57
Get sequence