MirGeneDB

MirGeneDB ID

Lgi-Mir-252-P1

Family name MIR-252 (all species)
Seed UAAGUAC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-252a
Paralogues Lgi-Mir-252-P2 
Orthologues Aae-Mir-252-P1  Bfl-Mir-252-P1  Bge-Mir-252-P1-v1  Bge-Mir-252-P1-v2  Cbr-Mir-252-P1  Cel-Mir-252-P1  Cgi-Mir-252-P1  Cte-Mir-252-P1  Dan-Mir-252-P1-v1  Dan-Mir-252-P1-v2  Dme-Mir-252-P1-v1  Dme-Mir-252-P1-v2  Dmo-Mir-252-P1-v1  Dmo-Mir-252-P1-v2  Dpu-Mir-252-P1-v1  Dpu-Mir-252-P1-v2  Hme-Mir-252-P1  Isc-Mir-252-P1-v1  Isc-Mir-252-P1-v2  Lan-Mir-252-P1a  Lan-Mir-252-P1b  Pfl-Mir-252-P1  Pmi-Mir-252-P1  Sko-Mir-252-P1  Spu-Mir-252-P1  Tca-Mir-252-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_150: 483957-484016 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-252-P1)
Mir-252-P1 LOTGIsca_150: 483957-484016 [-] Ensembl
Mir-252-P2 LOTGIsca_150: 486133-486191 [-] Ensembl
Mir-2001 LOTGIsca_150: 486301-486357 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAACAAACAAAACAAAGAUCGAAGUAAAUACUAAGUACUGGUGCCGCGGGAGGUUAUAAUUGAUUACUCCUGCGACUCUUGUGCUUACUAUGUCAAGCGAUCAAUAACAUCAUAGACUUC
Get precursor sequence
Structure
        10          20        30        40        50         
AAACAAACAAAACAAAG--|   AAGUAA   C       U  UGC       GGUUAUA 
                   AUCG      AUA UAAGUAC GG   CGCGGGA       A
                   UAGC      UAU AUUCGUG UC   GCGUCCU       U
CUUCAGAUACUACAAUAAC^   GAACUG   C       U  UCA       CAUUAGU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-252-P1_5p

MirBase accessionMIMAT0009591
Sequence
0- CUAAGUACUGGUGCCGCGGGA -21
Get sequence
Star sequence

Lgi-Mir-252-P1_3p* (predicted)

MirBase accessionNone
Sequence
39- CUGCGACUCUUGUGCUUACUA -60
Get sequence