MirGeneDB

MirGeneDB ID

Spu-Mir-252-P1

Family name MIR-252 (all species)
Seed UAAGUAC
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-252a
Paralogues Spu-Mir-252-P2 
Orthologues Aae-Mir-252-P1  Bfl-Mir-252-P1  Bge-Mir-252-P1-v1  Bge-Mir-252-P1-v2  Cbr-Mir-252-P1  Cel-Mir-252-P1  Cgi-Mir-252-P1  Cte-Mir-252-P1  Dan-Mir-252-P1-v1  Dan-Mir-252-P1-v2  Dme-Mir-252-P1-v1  Dme-Mir-252-P1-v2  Dmo-Mir-252-P1-v1  Dmo-Mir-252-P1-v2  Dpu-Mir-252-P1-v1  Dpu-Mir-252-P1-v2  Hme-Mir-252-P1  Isc-Mir-252-P1-v1  Isc-Mir-252-P1-v2  Lan-Mir-252-P1a  Lan-Mir-252-P1b  Lgi-Mir-252-P1  Pfl-Mir-252-P1  Pmi-Mir-252-P1  Sko-Mir-252-P1  Tca-Mir-252-P1 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold1276: 118845-118928 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-252-P1)
Mir-2001 Scaffold1276: 110932-110992 [+] Ensembl
Mir-252-P2 Scaffold1276: 117467-117526 [+] Ensembl
Mir-252-P1 Scaffold1276: 118845-118928 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACGUCGCUAAACACGUGACUAUGUUCCGUCCUAAGUACUAGUGCCGUAGGUUAACUGAGAAGGAAAGUGAAGCUAGACUAUAGCUUCUCAGACCUGUAGUACUAGUACUUAACAUGGCACAAGUCGAAUUCACCGUGGAAGCUU
Get precursor sequence
Structure
        10           20        30        40        50        60        70 
ACGUCGCUAAACACGUG---|  A   U    CC             CG      AACUGAGAAGGAAAGUGA 
                    ACU UGU CCGU  UAAGUACUAGUGC  UAGGUU                  A
                    UGA ACA GGUA  AUUCAUGAUCAUG  GUCCAG                  G
UUCGAAGGUGCCACUUAAGC^  -   C    CA             AU      ACUCUUCGAUAUCAGAUC 
  140       130        120       110       100        90        80
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-252-P1_5p

MirBase accessionMIMAT0009672
Sequence
0- CUAAGUACUAGUGCCGUAGGUU -22
Get sequence
Star sequence

Spu-Mir-252-P1_3p*

MirBase accessionNone
Sequence
62- CCUGUAGUACUAGUACUUAACA -84
Get sequence