MirGeneDB

MirGeneDB ID

Spu-Mir-252-P2

Family name MIR-252 (all species)
Seed UAAGUAG
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-252b
Paralogues Spu-Mir-252-P1 
Orthologues Asu-Mir-252-P2  Bfl-Mir-252-P2  Bge-Mir-252-P2  Cbr-Mir-252-P2  Cel-Mir-252-P2  Cgi-Mir-252-P2  Cte-Mir-252-P2  Dan-Mir-252-P2  Dme-Mir-252-P2  Dmo-Mir-252-P2  Dpu-Mir-252-P2  Hme-Mir-252-P2  Isc-Mir-252-P2  Lan-Mir-252-P2a  Lan-Mir-252-P2b  Lgi-Mir-252-P2  Pfl-Mir-252-P2  Pmi-Mir-252-P2  Sko-Mir-252-P2  Tca-Mir-252-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold1276: 117467-117526 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-252-P2)
Mir-2001 Scaffold1276: 110932-110992 [+] Ensembl
Mir-252-P2 Scaffold1276: 117467-117526 [+] Ensembl
Mir-252-P1 Scaffold1276: 118845-118928 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACGUCUUCAUCUUGAGUCCACGUUGCCGAUCUAAGUAGUAGUGCCGCAGGUACUGAUUUUUAAGUGAUACCUGUACACGGCUACUUACAUUGGCAACGAGCUGGAAAAUCAACUCUUCGU
Get precursor sequence
Structure
        10        20          30        40        50          
ACGUCUUCAUCUUGAGUCCA--|         C        A   CC       CUGAUUU 
                      CGUUGCCGAU UAAGUAGU GUG  GCAGGUA       \
                      GCAACGGUUA AUUCAUCG CAC  UGUCCAU       U
UGCUUCUCAACUAAAAGGUCGA^         C        G   A-       AGUGAAU 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-252-P2_5p

MirBase accessionMIMAT0009673
Sequence
0- CUAAGUAGUAGUGCCGCAGGUA -22
Get sequence
Star sequence

Spu-Mir-252-P2_3p*

MirBase accessionNone
Sequence
39- CCUGUACACGGCUACUUACAU -60
Get sequence