MirGeneDB

MirGeneDB ID

Lgi-Mir-252-P2

Family name MIR-252 (all species)
Seed UAAGUAG
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-252b
Paralogues Lgi-Mir-252-P1 
Orthologues Asu-Mir-252-P2  Bfl-Mir-252-P2  Bge-Mir-252-P2  Cbr-Mir-252-P2  Cel-Mir-252-P2  Cgi-Mir-252-P2  Cte-Mir-252-P2  Dan-Mir-252-P2  Dme-Mir-252-P2  Dmo-Mir-252-P2  Dpu-Mir-252-P2  Hme-Mir-252-P2  Isc-Mir-252-P2  Lan-Mir-252-P2a  Lan-Mir-252-P2b  Pfl-Mir-252-P2  Pmi-Mir-252-P2  Sko-Mir-252-P2  Spu-Mir-252-P2  Tca-Mir-252-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_150: 486133-486191 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-252-P2)
Mir-252-P1 LOTGIsca_150: 483957-484016 [-] Ensembl
Mir-252-P2 LOTGIsca_150: 486133-486191 [-] Ensembl
Mir-2001 LOTGIsca_150: 486301-486357 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AUGUGAAGGUUGUUGUCUGUCAUGGUAACUAUAAGUAGUGGUGCCGCAGGUAUGAUAUUGAUGGCUACCUGCUUCAUCACUAUUUACUGUUAAUCUGAUAAUGUCACCAAGAUGGAGUU
Get precursor sequence
Structure
        10          20        30        40        50         
AUGUGAAGGUUGUUGUC--|    UGG    UA            CC       UGAUAU 
                   UGUCA   UAAC  UAAGUAGUGGUG  GCAGGUA      \
                   AUAGU   AUUG  AUUUAUCACUAC  CGUCCAU      U
UUGAGGUAGAACCACUGUA^    CUA    UC            UU       CGGUAG 
       110       100        90        80        70        60
Deep sequencing
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-252-P2_5p (predicted)

MirBase accessionMIMAT0009682
Sequence
0- AUAAGUAGUGGUGCCGCAGGUA -22
Get sequence
Star sequence

Lgi-Mir-252-P2_3p* (predicted)

MirBase accessionNone
Sequence
37- CCUGCUUCAUCACUAUUUACUG -59
Get sequence