MirGeneDB

MirGeneDB ID

Bge-Mir-2001-P1

Family name MIR-2001 (all species)
Seed UUGUGAC
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues Bge-Mir-2001-P2 
Orthologues Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) B. germanica
Node of Origin (family) Bilateria
Genome context
(Bger_2.0)
KZ617672.1: 125160-125225 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACUGAGCGGGGAUCGAAGAAGGGAUUUUGGUUUGUGACCGCCAUAAUGGGCAUUUCUUACAAUUCACUACAAUGCUCGUUAUCACGUUCGCAAUUCCGACGCCCUUCUAUGACGUCAUCUUCAGCU
Get precursor sequence
Structure
        10          20        30         40        50        60  
ACUGAGCGGGGAUCGAA--|     AUU    U-      C  CC          UUUCUUACA 
                   GAAGGG   UUGG  UUGUGA CG  AUAAUGGGCA         A
                   CUUCCC   AGCC  AACGCU GC  UAUUGCUCGU         U
UCGACUUCUACUGCAGUAU^     GC-    UU      U  AC          AACAUCACU 
    120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Mature sequence

Bge-Mir-2001-P1_5p

MirBase accessionNone
Sequence
0- UUUGUGACCGCCAUAAUGGGCA -22
Get sequence
Star sequence

Bge-Mir-2001-P1_3p* (predicted)

MirBase accessionNone
Sequence
44- CUCGUUAUCACGUUCGCAAUUC -66
Get sequence