MirGeneDB

MirGeneDB ID

Pfl-Mir-2001

Family name MIR-2001 (all species)
Seed UGUGACC
Species Ptychodera (Ptychodera flava)
MiRBase ID
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD368470.1: 38645-38714 [+]
Precursor
(pre-Mir +30nt flank)
CCCGUUUCUGUAUGUAUGUGUGUCACGCUGUUGUGACCGUUAUAAUGGGCAUCUCAGGACGCUAAGGUGCCAAAAAAUGCCUAUUCUAACGUUCAUAAUAGCGUGGUAUAUGGAAAGCACCAGACUAACA
Get precursor sequence
Structure
        10          20        30        40        50        60    
CCCGUUUCUGUAUGUAU--|   GU             C     U         CUCAGGACGCU 
                   GUGU  CACGCUGUUGUGA CGUUA AAUGGGCAU           A
                   UAUA  GUGCGAUAAUACU GCAAU UUAUCCGUA           A
ACAAUCAGACCACGAAAGG^   UG             U     C         AAAAACCGUGG 
.       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-2001_5p

MirBase accessionNone
Sequence
0- UUGUGACCGUUAUAAUGGGCAUC -23
Get sequence
Star sequence

Pfl-Mir-2001_3p*

MirBase accessionNone
Sequence
47- UGCCUAUUCUAACGUUCAUAAUA -70
Get sequence