MirGeneDB

MirGeneDB ID

Hme-Mir-2001

Family name MIR-2001 (all species)
Seed UUGUGAC
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Hmel_1)
HE669201: 27587-27644 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAACAAAGAAGAAUUUGUUAGCGAAGUUGGUUUGUGACCGUCACUAACGGGCAGUUGUGUGUUUGCUCGUUUUGACGAUCGCAAAAUGAACUCGCUUGACGUUAAUACAUCAUUUUUG
Get precursor sequence
Structure
        10           20        30         40        50        
AAACAAAGAAGAAUUUGUU---|    A   G    -    C     CU        GUUG 
                      AGCGA GUU GUUU GUGA CGUCA  AACGGGCA    U
                      UCGCU CAA UAAA CGCU GCAGU  UUGCUCGU    G
GUUUUUACUACAUAAUUGCAGU^    -   G    A    A     U-        UUGU 
      110       100         90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Mature sequence

Hme-Mir-2001_5p

MirBase accessionNone
Sequence
0- UUUGUGACCGUCACUAACGGGCA -23
Get sequence
Star sequence

Hme-Mir-2001_3p*

MirBase accessionNone
Sequence
35- CUCGUUUUGACGAUCGCAAAAUG -58
Get sequence