MirGeneDB

MirGeneDB ID

Pmi-Mir-2001

Family name MIR-2001 (all species)
Seed UGUGACC
Species Bat starfish (Patiria miniata)
MiRBase ID pmi-mir-2001
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pmin1)
JH782853.1: 10000-10059 [-]
Precursor
(pre-Mir +30nt flank)
AUUAUUCUCCACUGAUUGUCAGUUUCGUUUAUGUGACCGUUACAAUGGGCAUGUUAUAUCCUAAAAAUGCCCGCUGCAGCGUUCACAACAACGGGCAUGACCAGAACAACCCAAAACCAU
Get precursor sequence
Structure
        10          20        30        40        50         
AUUAUUCUCCACUGAUU--|   GU      UA     C    A  A       GUUAUA 
                   GUCA  UUCGUU  UGUGA CGUU CA UGGGCAU      U
                   CAGU  GGGCAA  ACACU GCGA GU GCCCGUA      C
UACCAAAACCCAACAAGAC^   AC      CA     U    C  C       AAAAUC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Em To
Mature sequence

Pmi-Mir-2001_5p

MirBase accessionMIMAT0032175
Sequence
0- AUGUGACCGUUACAAUGGGCAU -22
Get sequence
Star sequence

Pmi-Mir-2001_3p*

MirBase accessionNone
Sequence
38- GCCCGCUGCAGCGUUCACAACA -60
Get sequence