MirGeneDB

MirGeneDB ID

Cbr-Mir-2001

Family name MIR-2001 (all species)
Seed UGUGACC
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-360
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(CB4)
X: 11259477-11259537 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGAAUAUUCCAUAAAAAAGCGCCUAGGGUUUUGUGACCGUUGUUACGGUCAAUUCAUGUCUGACACAAUGACCGUAAUCCCGUUCACAACACCUUGUGUGGCUUGAAUAAUGAAAUUGUAU
Get precursor sequence
Structure
        10        20           30        40        50          
UGAAUAUUCCAUAAAAAAGC   ---|     U      C  UU          AUUCAUGU 
                    GCC   UAGGGU UUGUGA CG  GUUACGGUCA        \
                    CGG   GUUCCA AACACU GC  UAAUGCCAGU        C
UAUGUUAAAGUAAUAAGUU-   UGU^     C      U  CC          AACACAGU 
 .       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Mature sequence

Cbr-Mir-2001_5p

MirBase accessionNone
Sequence
0- UUGUGACCGUUGUUACGGUCA -21
Get sequence
Star sequence

Cbr-Mir-2001_3p*

MirBase accessionMIMAT0001303
Sequence
40- ACCGUAAUCCCGUUCACAACA -61
Get sequence