MirGeneDB

MirGeneDB ID

Cel-Mir-2001

Family name MIR-2001 (all species)
Seed UGUGACC
Species Roundworm (Caenorhabditis elegans)
MiRBase ID cel-mir-360
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ce11)
chrX: 5919174-5919235 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCGGCAUUCUGUUAGGAAGCAUCAAUGUGUUGUGACCGUUGUUACGGUCAAUUUGCAAAUUGAAAAAAUGACCGUAAUCCCGUUCACAAUACAUUGUUCGUUUUCUCCAAAGGUGAUUCAU
Get precursor sequence
Structure
        10         20         30        40        50        60
UUCGGCAUUCUGUUAGG-    AU-|            C  UU          AUUUGCAA 
                  AAGC   CAAUGUGUUGUGA CG  GUUACGGUCA        A
                  UUUG   GUUACAUAACACU GC  UAAUGCCAGU        U
UACUUAGUGGAAACCUCU    CUU^            U  CC          AAAAAAGU 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Wt Da Ea Mi Yo Yo
Mature sequence

Cel-Mir-2001_5p

MirBase accessionMIMAT0015121
Sequence
0- UUGUGACCGUUGUUACGGUCA -21
Get sequence
Validated targets microrna.org: MIMAT0015121
Star sequence

Cel-Mir-2001_3p*

MirBase accessionMIMAT0000702
Sequence
41- ACCGUAAUCCCGUUCACAAUA -62
Get sequence
Validated targets microrna.org: MIMAT0000702
TargetScanWorm: cel-miR-360