MirGeneDB

MirGeneDB ID

Sko-Mir-2001

Family name MIR-2001 (all species)
Seed UGUGACC
Species Saccoglossus (Saccoglossus kowalevskii)
MiRBase ID sko-mir-2001
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Skow_1.1)
NW_003126934.1: 20664-20731 [-]
Clustered MiRNAs
(< 10kb from Mir-2001)
Mir-252-P1 NW_003126934.1: 13977-14037 [-]
Mir-252-P2 NW_003126934.1: 19612-19671 [-]
Mir-2001 NW_003126934.1: 20664-20731 [-]
Precursor
(pre-Mir +30nt flank)
CAAAACGUUUUUAAUAUAUGUUUCACGUUGUUGUGACCGUUAUAAUGGGCAUAUCAAGCACCAAUGCAAUCAUAAUGCCUACUGUAGCGUUUACAACAAUGGGGGACAUUCUAUCGACUUCCGAAGAC
Get precursor sequence
Structure
        10          20        30        40        50        60   
CAAAACGUUUUUAAUAU--|   UU A           C       A       AUCAAGCACC 
                   AUGU  C CGUUGUUGUGA CGUUAUA UGGGCAU          A
                   UACA  G GUAACAACAUU GCGAUGU AUCCGUA          A
CAGAAGCCUUCAGCUAUCU^   GG G           U       C       AUACUAACGU 
      120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sko-Mir-2001_5p

MirBase accessionMIMAT0009735
Sequence
0- UUGUGACCGUUAUAAUGGGCAU -22
Get sequence
Star sequence

Sko-Mir-2001_3p* (predicted)

MirBase accessionNone
Sequence
46- GCCUACUGUAGCGUUUACAACA -68
Get sequence