MirGeneDB

MirGeneDB ID

Dmo-Mir-2001

Family name MIR-2001 (all species)
Seed UUGUGAC
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-274
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dme-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dmoj_caf1)
scaffold_6680: 18485500-18485576 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGUCAAGUGUAUCCUGUGUUGCAGUUUCGGUUUGUGACCGACACUAACGGGUAGUUGAGGCAUCUCGUAUUCGCUGUUUUAUACUCGUUUUUGCGAUCACAAAUUCUGAAAUUGCAACGAAACGCAACGAAAAUGAA
Get precursor sequence
Structure
        10          20        30          40        50        60       
UGUCAAGUGUAUCCUGU--             --|      C  A  CU       AGUUGAGGCAUCUC 
                   GUUGCAGUUUCGG  UUUGUGA CG CA  AACGGGU              G
                   CAACGUUAAAGUC  AAACACU GC GU  UUGCUCA              U
AAGUAAAAGCAACGCAAAG             UU^      A  -  UU       UAUUUUGUCGCUUA 
     130       120       110       100         90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-2001_5p

MirBase accessionMIMAT0008655
Sequence
0- UUUGUGACCGACACUAACGGGU -22
Get sequence
Star sequence

Dmo-Mir-2001_3p*

MirBase accessionNone
Sequence
54- UCGUUUUUGCGAUCACAAAUUCU -77
Get sequence