MirGeneDB

MirGeneDB ID

Dme-Mir-2001

Family name MIR-2001 (all species)
Seed UUGUGAC
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-274
Paralogues
Orthologues Bge-Mir-2001-P1  Bge-Mir-2001-P2  Cbr-Mir-2001  Cel-Mir-2001  Cgi-Mir-2001  Cte-Mir-2001  Dan-Mir-2001  Dmo-Mir-2001  Hme-Mir-2001  Isc-Mir-2001  Lan-Mir-2001-P1  Lan-Mir-2001-P2  Lgi-Mir-2001  Pfl-Mir-2001  Pmi-Mir-2001  Sko-Mir-2001  Spu-Mir-2001 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(dm6)
chr3L: 11656937-11657002 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGGUGACGAAUCCUGUGUUGCAGUUUCGUUUUGUGACCGACACUAACGGGUAAUUGUUUGGCCGCCAGGAUUACUCGUUUUUGCGAUCACAAAUUAUGAAAUUGCAGCAAAACUCAACGAAAUUG
Get precursor sequence
Structure
        10        20        30          40        50        60   
UUGGUGACGAAUCCUGUG            --|      C  A  CU       AAUUGUUUGG 
                  UUGCAGUUUCGU  UUUGUGA CG CA  AACGGGU          \
                  GACGUUAAAGUA  AAACACU GC GU  UUGCUCA          C
GUUAAAGCAACUCAAAAC            UU^      A  -  UU       UUAGGACCGC 
    120       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-2001_5p

MirBase accessionMIMAT0000332
Sequence
0- UUUGUGACCGACACUAACGGGU -22
Get sequence
Validated targets microrna.org: MIMAT0000332
TargetScanFly: dme-miR-274
Star sequence

Dme-Mir-2001_3p*

MirBase accessionMIMAT0020800
Sequence
45- UCGUUUUUGCGAUCACAAAUU -66
Get sequence